Supramolecular Hydrogels Generated from Self-Assembly of Guanosine Derivatives and G-Quadruplex DNA Recognition by Small Molecules

Das, Rabindra Nath (2014) Supramolecular Hydrogels Generated from Self-Assembly of Guanosine Derivatives and G-Quadruplex DNA Recognition by Small Molecules. PhD thesis, Indian Institute of Science Education and Research Kolkata.

PDF (PhD thesis of Rabindra Nath Das) Rabindra_Nath_Das-Thesis_Final.pdf - Submitted Version Restricted to Repository staff only Download (4MB)

Abstract

The self-assembly of biomolecules, optimized during billions of years of evolution, is an inspirational approach to the design and fabrication of novel supramolecular structures and complex nanoarchitectures. The self-association of guanosine derivatives to form G-quartet has received considerable interest in various areas of research, ranging from supramolecular chemistry to molecular biology and nanotechnology. we have designed a lipophilic dinucleoside containing complementary guanosine and cytidine based on “Click Chemistry” at the end groups able to form stable supramolecular structure in the membrane and facilitate the ionic transport processes. The ion channel activity have been demonstrated using voltage-clamp experiments which show that the dinucleoside derivative forms discrete channels with stable and large pores with nanosiemen (nS) conductance in phospholipid membrane. We have further demonstrated that the channel formation can be efficiently inhbitited using the cytosine and guanosine. It has been reported that formation of intramolecular G-quadruplexes at the telomeric G-rich strand inhibits the activity of telomerase. Therefore, small molecules that can bind and stabilize the intramolecular telomeric G-quadruplexes have become an attractive strategy for the development of potential anticancer drug targets. The design and synthesis of water soluble bis(phenylenethynyl) amides linked to pyridine at 2, 6 position that stabilize human telomeric G-quadruplex DNA and act as swtich-on probes for human telomeric G-quadruplex DNA was described later. Then it has been shown that boolean logic systems can be fabricated9 on the basis of different interaction modes of small molecules with the quadruplex topology. As a proof of principle, the interactions of small molecules such as pyridyl bis-indole amide (PBIA), thiazole orange (TO) among themselves and with the c-kit2 promoter quadruplex sequence d[GGGCGGGCGCGAGGGAGGGG] have been manifested to devise XNOR, NOR, AND, NAND and NOT logic gates with pH as an external modulator.

Actions (login required)

View Item